Review



assays signal seeker acetyl lysine detection kit cytoskeleton bk163 deposited data liver microarray analysis gene expression omnibus geo  (Cytoskeleton Inc)


Bioz Verified Symbol Cytoskeleton Inc is a verified supplier
Bioz Manufacturer Symbol Cytoskeleton Inc manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 94

    Structured Review

    Cytoskeleton Inc assays signal seeker acetyl lysine detection kit cytoskeleton bk163 deposited data liver microarray analysis gene expression omnibus geo
    Assays Signal Seeker Acetyl Lysine Detection Kit Cytoskeleton Bk163 Deposited Data Liver Microarray Analysis Gene Expression Omnibus Geo, supplied by Cytoskeleton Inc, used in various techniques. Bioz Stars score: 94/100, based on 11 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/deposited+data+microarray+data/Signal-Seeker+Acetyl-Lysine+Detection+Kit/pm32413334-278-72-77
    Average 94 stars, based on 11 article reviews
    assays signal seeker acetyl lysine detection kit cytoskeleton bk163 deposited data liver microarray analysis gene expression omnibus geo - by Bioz Stars, 2026-10
    94/100 stars

    Images

    Related Articles

    Microarray:

    Article Title: Untangling Determinants of Enhanced Health and Lifespan through a Multi-omics Approach in Mice.
    Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies rabbit anti-SHMT1 Sigma-Aldrich cat# HPA023314; RRID: AB_1856830 rabbit anti-Glutathione S-Transferase A1/A2 Millipore Sigma cat#ABS1651 rabbit anti-MAT1A Abcam cat#ab129176; RRID: AB_11145300 rabbit anti-SIRT1 Cell Signaling Technology cat#9475S; RRID: AB_2617130 rabbit anti-CBS Abcam cat# ab135626; RRID: AB_2814659 rabbit anti-AMPKa Cell Signaling Technology cat# 2535S; RRID: AB_331250 rabbit anti-SIRT6 Cell Signaling Technology cat#12486S; RRID: AB_2636969 HRP-conjugated anti-acetyl lysine Cytoskeleton cat#AAC03-HRP-S rabbit anti-NAMPT Bethyl Laboratories cat#A300-372A-M; RRID: AB_2251232 Critical Commercial Assays Signal-Seeker Acetyl-Lysine Detection Kit Cytoskeleton BK163 Deposited Data Liver microarray analysis Gene Expression Omnibus (GEO) repository GEO: GSE124294 Oligonucleotides IDT m_Gstt2_FW N/A CCGTGGATATACTCAAACAGCAC m_Gstt2_Rv N/A AGATGGCTGTCCTTTCGGTC m_Cyp3a11_FW N/A ACCTGGGTGCTCCTAGCAAT m_Cyp3a11_Rv N/A GCACAGTGCCTAAAAATGGCA m_Cbs_FW N/A GCAGTTCAAACCGATCCACC m_Cbs_Rv N/A GCCTGGTCTCGTGATTGGAT m_Fads2_FW N/A GCCCCTTGAGTATGGCAAGA m_Fads2_Rv N/A TACATAGGGATGAGCAGCGG m_Actb_FW N/A CACTGTCGAGTCGCGTCC m_Actb_Rv N/A CGCAGCGATATCGTCATCCA m_Gapdh_FW N/A AAGAGGGATGCTGCCCTTAC m_Gapdh_Rv N/A ATCCGTTCACACCGACCTTC m_Rn18s_FW N/A GTAACCCGTTGAACCCCATT m_Rn18s_Rv N/A CCATCCAATCGGTAGTAGCG Software and Algorithms Prism 6.0 GraphPad http://www.graphpad.com/scientific- software/prism; RRID: SCR_015807 Microsoft Excel (version 16.19) Microsoft https://www.microsoft.com/en-gb/; RRID: SCR_016137 MetaboAnalyst (versions 3.0, 4.0) Web-based resource (McGill University, Canada) https://www.metaboanalyst.ca/ MetaboAnalyst/faces/home.xhtml ImageJ National Institutes of Health (NIH) https://imagej.nih.gov/ij/; RRID: SCR_003070 OriginLab 2018 OriginLab corporation https://www.originlab.com Cell Metabolism 32, 100–116.e1–e4, July 7, 2020 e1 ..

    Gene Expression:

    Article Title: Untangling Determinants of Enhanced Health and Lifespan through a Multi-omics Approach in Mice.
    Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies rabbit anti-SHMT1 Sigma-Aldrich cat# HPA023314; RRID: AB_1856830 rabbit anti-Glutathione S-Transferase A1/A2 Millipore Sigma cat#ABS1651 rabbit anti-MAT1A Abcam cat#ab129176; RRID: AB_11145300 rabbit anti-SIRT1 Cell Signaling Technology cat#9475S; RRID: AB_2617130 rabbit anti-CBS Abcam cat# ab135626; RRID: AB_2814659 rabbit anti-AMPKa Cell Signaling Technology cat# 2535S; RRID: AB_331250 rabbit anti-SIRT6 Cell Signaling Technology cat#12486S; RRID: AB_2636969 HRP-conjugated anti-acetyl lysine Cytoskeleton cat#AAC03-HRP-S rabbit anti-NAMPT Bethyl Laboratories cat#A300-372A-M; RRID: AB_2251232 Critical Commercial Assays Signal-Seeker Acetyl-Lysine Detection Kit Cytoskeleton BK163 Deposited Data Liver microarray analysis Gene Expression Omnibus (GEO) repository GEO: GSE124294 Oligonucleotides IDT m_Gstt2_FW N/A CCGTGGATATACTCAAACAGCAC m_Gstt2_Rv N/A AGATGGCTGTCCTTTCGGTC m_Cyp3a11_FW N/A ACCTGGGTGCTCCTAGCAAT m_Cyp3a11_Rv N/A GCACAGTGCCTAAAAATGGCA m_Cbs_FW N/A GCAGTTCAAACCGATCCACC m_Cbs_Rv N/A GCCTGGTCTCGTGATTGGAT m_Fads2_FW N/A GCCCCTTGAGTATGGCAAGA m_Fads2_Rv N/A TACATAGGGATGAGCAGCGG m_Actb_FW N/A CACTGTCGAGTCGCGTCC m_Actb_Rv N/A CGCAGCGATATCGTCATCCA m_Gapdh_FW N/A AAGAGGGATGCTGCCCTTAC m_Gapdh_Rv N/A ATCCGTTCACACCGACCTTC m_Rn18s_FW N/A GTAACCCGTTGAACCCCATT m_Rn18s_Rv N/A CCATCCAATCGGTAGTAGCG Software and Algorithms Prism 6.0 GraphPad http://www.graphpad.com/scientific- software/prism; RRID: SCR_015807 Microsoft Excel (version 16.19) Microsoft https://www.microsoft.com/en-gb/; RRID: SCR_016137 MetaboAnalyst (versions 3.0, 4.0) Web-based resource (McGill University, Canada) https://www.metaboanalyst.ca/ MetaboAnalyst/faces/home.xhtml ImageJ National Institutes of Health (NIH) https://imagej.nih.gov/ij/; RRID: SCR_003070 OriginLab 2018 OriginLab corporation https://www.originlab.com Cell Metabolism 32, 100–116.e1–e4, July 7, 2020 e1 ..

    Software:

    Article Title: Untangling Determinants of Enhanced Health and Lifespan through a Multi-omics Approach in Mice.
    Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies rabbit anti-SHMT1 Sigma-Aldrich cat# HPA023314; RRID: AB_1856830 rabbit anti-Glutathione S-Transferase A1/A2 Millipore Sigma cat#ABS1651 rabbit anti-MAT1A Abcam cat#ab129176; RRID: AB_11145300 rabbit anti-SIRT1 Cell Signaling Technology cat#9475S; RRID: AB_2617130 rabbit anti-CBS Abcam cat# ab135626; RRID: AB_2814659 rabbit anti-AMPKa Cell Signaling Technology cat# 2535S; RRID: AB_331250 rabbit anti-SIRT6 Cell Signaling Technology cat#12486S; RRID: AB_2636969 HRP-conjugated anti-acetyl lysine Cytoskeleton cat#AAC03-HRP-S rabbit anti-NAMPT Bethyl Laboratories cat#A300-372A-M; RRID: AB_2251232 Critical Commercial Assays Signal-Seeker Acetyl-Lysine Detection Kit Cytoskeleton BK163 Deposited Data Liver microarray analysis Gene Expression Omnibus (GEO) repository GEO: GSE124294 Oligonucleotides IDT m_Gstt2_FW N/A CCGTGGATATACTCAAACAGCAC m_Gstt2_Rv N/A AGATGGCTGTCCTTTCGGTC m_Cyp3a11_FW N/A ACCTGGGTGCTCCTAGCAAT m_Cyp3a11_Rv N/A GCACAGTGCCTAAAAATGGCA m_Cbs_FW N/A GCAGTTCAAACCGATCCACC m_Cbs_Rv N/A GCCTGGTCTCGTGATTGGAT m_Fads2_FW N/A GCCCCTTGAGTATGGCAAGA m_Fads2_Rv N/A TACATAGGGATGAGCAGCGG m_Actb_FW N/A CACTGTCGAGTCGCGTCC m_Actb_Rv N/A CGCAGCGATATCGTCATCCA m_Gapdh_FW N/A AAGAGGGATGCTGCCCTTAC m_Gapdh_Rv N/A ATCCGTTCACACCGACCTTC m_Rn18s_FW N/A GTAACCCGTTGAACCCCATT m_Rn18s_Rv N/A CCATCCAATCGGTAGTAGCG Software and Algorithms Prism 6.0 GraphPad http://www.graphpad.com/scientific- software/prism; RRID: SCR_015807 Microsoft Excel (version 16.19) Microsoft https://www.microsoft.com/en-gb/; RRID: SCR_016137 MetaboAnalyst (versions 3.0, 4.0) Web-based resource (McGill University, Canada) https://www.metaboanalyst.ca/ MetaboAnalyst/faces/home.xhtml ImageJ National Institutes of Health (NIH) https://imagej.nih.gov/ij/; RRID: SCR_003070 OriginLab 2018 OriginLab corporation https://www.originlab.com Cell Metabolism 32, 100–116.e1–e4, July 7, 2020 e1 ..



    Similar Products

    94
    Cytoskeleton Inc assays signal seeker acetyl lysine detection kit cytoskeleton bk163 deposited data liver microarray analysis gene expression omnibus geo
    Assays Signal Seeker Acetyl Lysine Detection Kit Cytoskeleton Bk163 Deposited Data Liver Microarray Analysis Gene Expression Omnibus Geo, supplied by Cytoskeleton Inc, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/deposited+data+microarray+data/Signal-Seeker+Acetyl-Lysine+Detection+Kit/pm32413334-278-72-77
    Average 94 stars, based on 1 article reviews
    assays signal seeker acetyl lysine detection kit cytoskeleton bk163 deposited data liver microarray analysis gene expression omnibus geo - by Bioz Stars, 2026-10
    94/100 stars
      Buy from Supplier

    94
    MedChemExpress hy k1079 deposited data mrna microarray data
    Hy K1079 Deposited Data Mrna Microarray Data, supplied by MedChemExpress, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/deposited+data+microarray+data/One+Step+TUNEL+Apoptosis+Detection+Kit/pm38758648-183-178-176
    Average 94 stars, based on 1 article reviews
    hy k1079 deposited data mrna microarray data - by Bioz Stars, 2026-10
    94/100 stars
      Buy from Supplier

    96
    Genecopoeia lf032 deposited data rna microarray ncbi geo geo
    Lf032 Deposited Data Rna Microarray Ncbi Geo Geo, supplied by Genecopoeia, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/deposited+data+microarray+data/Secrete-Pair+Dual+Luminescence+Assay+Kit/pm31543404-181-32-30
    Average 96 stars, based on 1 article reviews
    lf032 deposited data rna microarray ncbi geo geo - by Bioz Stars, 2026-10
    96/100 stars
      Buy from Supplier

    97
    Cytiva Europe rpn2232 deposited data microarray
    Rpn2232 Deposited Data Microarray, supplied by Cytiva Europe, used in various techniques. Bioz Stars score: 97/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/deposited+data+microarray+data/Amersham+ECL+Prime+Western+Blotting+Detection+Reagent/pm31618630-185-139-136
    Average 97 stars, based on 1 article reviews
    rpn2232 deposited data microarray - by Bioz Stars, 2026-10
    97/100 stars
      Buy from Supplier

    96
    R&D Systems dy417 deposited data microarray dataset peritoneal macrophages
    Dy417 Deposited Data Microarray Dataset Peritoneal Macrophages, supplied by R&D Systems, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/deposited+data+microarray+data/Mouse+IL-10+DuoSet+ELISA/pm32049012-206-216-213
    Average 96 stars, based on 1 article reviews
    dy417 deposited data microarray dataset peritoneal macrophages - by Bioz Stars, 2026-10
    96/100 stars
      Buy from Supplier

    99
    Illumina Inc deposited data microarray data
    Deposited Data Microarray Data, supplied by Illumina Inc, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/deposited+data+microarray+data/pm31775048-185-125-123
    Average 99 stars, based on 1 article reviews
    deposited data microarray data - by Bioz Stars, 2026-10
    99/100 stars
      Buy from Supplier

    99
    TaKaRa deposited data raw gene microarray data
    Deposited Data Raw Gene Microarray Data, supplied by TaKaRa, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/deposited+data+microarray+data/TB+Green+Premix+Ex+Taq/pm30067981-234-203-201
    Average 99 stars, based on 1 article reviews
    deposited data raw gene microarray data - by Bioz Stars, 2026-10
    99/100 stars
      Buy from Supplier

    99
    TaKaRa race clonetech 634858 myone streptavine beads thermo 65601 deposited data microarray data geo gse89825 experimental models
    Race Clonetech 634858 Myone Streptavine Beads Thermo 65601 Deposited Data Microarray Data Geo Gse89825 Experimental Models, supplied by TaKaRa, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/deposited+data+microarray+data/SMARTer+RACE+5%E2%80%99%2F3%E2%80%99+Kit/pm29395921-393-80-81
    Average 99 stars, based on 1 article reviews
    race clonetech 634858 myone streptavine beads thermo 65601 deposited data microarray data geo gse89825 experimental models - by Bioz Stars, 2026-10
    99/100 stars
      Buy from Supplier

    96
    Illumina Inc deposited data gene expression microarray
    Deposited Data Gene Expression Microarray, supplied by Illumina Inc, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/deposited+data+microarray+data/pm30096312-291-271-269
    Average 96 stars, based on 1 article reviews
    deposited data gene expression microarray - by Bioz Stars, 2026-10
    96/100 stars
      Buy from Supplier

    Image Search Results